High-throughput (HTP) mass spectrometry (MS) is a burgeoning field characterized by the constant development of techniques to address the growing need for quicker sample analysis. Numerous analytical techniques, including AEMS and IR-MALDESI MS, demand a sample volume of at least 20 to 50 liters for complete analysis. Liquid atmospheric pressure matrix-assisted laser desorption/ionization (LAP-MALDI) MS is proposed as an alternative for ultra-high-throughput protein analysis, specifically requiring only femtomole quantities within 0.5 liters of solution. By using a high-speed XY-stage actuator, the 384-well microtiter sample plate is manipulated to achieve sample acquisition rates of up to 10 samples per second, with the corresponding data acquisition rate being 200 spectra per scan. Selleck Infigratinib Studies have shown that protein mixtures at a concentration of 2 molar can be analyzed at this speed, while individual protein solutions are amenable to analysis starting at a concentration of 0.2 molar. This makes LAP-MALDI MS a valuable platform for multiplexed, high-throughput protein analysis applications.

The straightneck squash, a subspecies of Cucurbita pepo, possesses a noticeably straight neck. For Florida's agricultural economy, the recticollis cucurbit crop stands as a vital element. In Northwest Florida's ~15-hectare straightneck squash field, early fall 2022 saw straightneck squash displaying virus-like symptoms. Symptoms included yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns on the leaves, and deformations on the fruit (Supplementary Figure 2). The disease incidence was approximately 30% of the field. The observed and distinctive symptoms of varying severities pointed to a potential multi-viral infection. To assess, seventeen plants were selected randomly. Selleck Infigratinib The testing of the plants for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using Agdia ImmunoStrips (USA), produced negative results. Employing the Quick-RNA Mini Prep kit (Cat No. 11-327, Zymo Research, USA), total RNA was isolated from 17 squash plants. A OneTaq RT-PCR Kit (Cat No. E5310S, NEB, USA) was employed to identify cucurbit chlorotic yellows virus (CCYV), as described by Jailani et al. (2021a), and to detect the presence of both watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2, as detailed in Hernandez et al. (2021), within the plant samples. Using primers specific to both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes, 12 of 17 plants tested positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae), while no plants tested positive for CCYV (Hernandez et al., 2021). Moreover, these twelve straightneck squash plants, according to Jailani et al. (2021b), were found to be positive for watermelon mosaic potyvirus (WMV), as determined using RT-PCR and sequencing. Comparing the partial RdRP genes of WCLaV-1 (OP389252) and WCLaV-2 (OP389254), 99% and 976% nucleotide identity, respectively, was observed with isolates KY781184 and KY781187 from China. Confirmation of the presence or absence of WCLaV-1 and WCLaV-2 was further pursued by means of a SYBR Green-based real-time RT-PCR assay utilizing unique MP primers specific to WCLaV-1 (Adeleke et al., 2022) and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Twelve out of seventeen straightneck squash plants exhibited both viral detections, corroborating the standard RT-PCR findings. Infection by WCLaV-1 and WCLaV-2, further exacerbated by WMV, produced more severe symptoms visible on both the leaves and fruits. Previous research indicated the first appearance of both viruses in the United States within watermelon crops of Texas, Florida, and Oklahoma, and Georgia, along with zucchini plants in Florida, as detailed in the literature (Hernandez et al., 2021; Hendricks et al., 2021; Gilford and Ali, 2022; Adeleke et al., 2022; Iriarte et al., 2023). In a first-of-its-kind report, WCLaV-1 and WCLaV-2 have been identified in straightneck squash within the United States. The observed results definitively show that WCLaV-1 and WCLaV-2, in single or dual infections, are successfully spreading to cucurbit crops in Florida, including those outside the watermelon variety. A heightened emphasis on assessing the methods of transmission used by these viruses is essential for the development of best management approaches.

Summer rot, a destructive affliction of apple orchards in the Eastern United States, is often caused by Colletotrichum species, resulting in the devastating disease known as bitter rot. The varying degrees of virulence and fungicide susceptibility exhibited by organisms in the acutatum species complex (CASC) and the gloeosporioides species complex (CGSC) necessitate the monitoring of their diversity, geographic distribution, and frequency percentages to ensure effective management of bitter rot. From a 662-isolate sample gathered from apple orchards in Virginia, isolates classified under CGSC were overwhelmingly prevalent, comprising 655% of the total, in contrast to the 345% share held by CASC isolates. In a study utilizing morphological and multi-locus phylogenetic analyses, 82 representative isolates were found to contain C. fructicola (262%), C. chrysophilum (156%), C. siamense (8%), C. theobromicola (8%) from CGSC and C. fioriniae (221%) and C. nymphaeae (16%) from CASC. Dominating the species list was C. fructicola, after which C. chrysophilum and C. fioriniae appeared. Virulence tests conducted on 'Honeycrisp' fruit demonstrated that C. siamense and C. theobromicola generated the most extensive and profound rot lesions. Early and late season harvests of detached fruit from 9 apple varieties, including a wild Malus sylvestris accession, underwent controlled testing to determine their vulnerability to attack from C. fioriniae and C. chrysophilum. All cultivars, when exposed to both representative species of bitter rot, showed susceptibility; the most notable susceptibility was seen in the Honeycrisp variety, while Malus sylvestris, accession PI 369855, was the most resistant. The Mid-Atlantic region sees substantial variability in the presence and number of Colletotrichum species, with this study offering location-specific insights into apple cultivars' vulnerability. To successfully manage the persistent and emerging threat of bitter rot in apple production, pre- and postharvest, our findings are essential.

Black gram, scientifically classified as Vigna mungo L., is a pivotal pulse crop in India, positioned third in terms of cultivation according to the findings of Swaminathan et al. (2023). At the Govind Ballabh Pant University of Agriculture & Technology, Pantnagar's Crop Research Center (29°02'22″N, 79°49'08″E), Uttarakhand, India, a black gram crop showed pod rot symptoms in August 2022, with a disease incidence of 80% to 92%. A fungal-like coating of white to salmon pink coloration was present on the affected pods. The severity of the symptoms began at the pod tips and then spread to encompass the whole of the pod, in later stages. Symptomatic pods contained seeds that were severely shriveled and incapable of germination. To determine the causative agent, ten plants were selected for analysis from the field. Using sterile techniques, symptomatic pods were fragmented, surface-disinfected with 70% ethanol for a minute, triple rinsed with sterilized water, dried on sterilized filter paper, and subsequently inoculated onto potato dextrose agar (PDA) enriched with 30 mg/liter streptomycin sulfate. Following a 7-day incubation period at 25 degrees Celsius, three Fusarium-like isolates (FUSEQ1, FUSEQ2, and FUSEQ3) were purified via single spore transfer and subsequently subcultured on PDA media. Selleck Infigratinib Fungal colonies on PDA, initially exhibiting a white to light pink, aerial, and floccose morphology, later matured into an ochre yellowish to buff brown pigmentation. Transferring isolates to carnation leaf agar (Choi et al., 2014) resulted in the growth of hyaline macroconidia, which exhibited 3 to 5 septa and dimensions of 204 to 556 µm in length and 30 to 50 µm in width (n = 50). These macroconidia were distinguished by tapered, elongated apical cells and prominent foot-shaped basal cells. Intercalary, globose, and thick chlamydospores were plentiful in the chains. Analysis demonstrated the absence of microconidia. The isolates, when assessed based on their morphological characteristics, were identified as belonging to the Fusarium incarnatum-equiseti species complex (FIESC), citing Leslie and Summerell (2006). For the molecular identification of the three isolates, total genomic DNA was prepared using the PureLink Plant Total DNA Purification Kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). This DNA served as template for amplification and sequencing of the internal transcribed spacer (ITS) region, the translation elongation factor-1 alpha (EF-1α) gene, and the second largest subunit of RNA polymerase (RPB2) gene, following the methodologies outlined in White et al., 1990 and O'Donnell, 2000. The GenBank database entries include sequences for ITS (OP784766, OP784777, OP785092), EF-1 (OP802797, OP802798, OP802799), and RPB2 (OP799667, OP799668, OP799669). The polyphasic identification procedure was conducted within the fusarium.org environment. With a similarity coefficient of 98.72%, FUSEQ1 closely resembled F. clavum. A complete 100% match was observed between FUSEQ2 and F. clavum. Conversely, FUSEQ3 presented a 98.72% degree of similarity with F. ipomoeae. Both the species identified are recognized as members of the FIESC taxonomic group, as per Xia et al. (2019). Greenhouse-grown, 45-day-old Vigna mungo plants, bearing seed pods, were used for the execution of pathogenicity tests. Using 10 ml of a conidial suspension from each isolate (107 conidia per ml), the plants were sprayed. A spray of sterile distilled water was administered to the control plants. Inoculated plants were kept in a greenhouse, at 25 degrees Celsius, by covering them in sterilized plastic bags, thereby maintaining the required humidity. Ten days post-inoculation, inoculated plants exhibited symptoms similar to those seen in the field; conversely, the control plants showed no symptoms.